Transcript: Human XM_006710321.2

PREDICTED: Homo sapiens oxysterol binding protein like 9 (OSBPL9), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL9 (114883)
Length:
2717
CDS:
152..2041

Additional Resources:

NCBI RefSeq record:
XM_006710321.2
NBCI Gene record:
OSBPL9 (114883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159131 GATACCAAGAAGTTGCCTATA pLKO.1 1757 CDS 100% 10.800 15.120 N OSBPL9 n/a
2 TRCN0000162447 CGAATGGTTCAGGTTGTGAAA pLKO.1 1115 CDS 100% 4.950 6.930 N OSBPL9 n/a
3 TRCN0000352912 CGAATGGTTCAGGTTGTGAAA pLKO_005 1115 CDS 100% 4.950 6.930 N OSBPL9 n/a
4 TRCN0000166810 CCACGTGAACTTGTCTCCAAA pLKO.1 652 CDS 100% 4.950 3.960 N OSBPL9 n/a
5 TRCN0000164901 GCGCTCTAGTACTGCTGTTAA pLKO.1 2348 3UTR 100% 13.200 9.240 N OSBPL9 n/a
6 TRCN0000352848 GCGCTCTAGTACTGCTGTTAA pLKO_005 2348 3UTR 100% 13.200 9.240 N OSBPL9 n/a
7 TRCN0000162333 CACAGAATTACTGCCGAGATT pLKO.1 1637 CDS 100% 4.950 3.465 N OSBPL9 n/a
8 TRCN0000159533 CCTGTTCATTCCAATCTTCTA pLKO.1 2122 3UTR 100% 4.950 3.465 N OSBPL9 n/a
9 TRCN0000165214 GCCTTTGGAAGGATGTCACTT pLKO.1 1830 CDS 100% 4.950 3.465 N OSBPL9 n/a
10 TRCN0000343431 GCCTTTGGAAGGATGTCACTT pLKO_005 1830 CDS 100% 4.950 3.465 N OSBPL9 n/a
11 TRCN0000165154 GCACAGAATTACTGCCGAGAT pLKO.1 1636 CDS 100% 4.050 2.835 N OSBPL9 n/a
12 TRCN0000343390 GCACAGAATTACTGCCGAGAT pLKO_005 1636 CDS 100% 4.050 2.835 N OSBPL9 n/a
13 TRCN0000105014 GCTTAATAGATTCTTCTGGAT pLKO.1 759 CDS 100% 2.640 1.848 N Osbpl9 n/a
14 TRCN0000325932 GCTTAATAGATTCTTCTGGAT pLKO_005 759 CDS 100% 2.640 1.848 N Osbpl9 n/a
15 TRCN0000160352 CCACACGTTGAAAGCATTTAT pLKO.1 2307 3UTR 100% 15.000 9.000 N OSBPL9 n/a
16 TRCN0000162710 CCTTTGGAAGGATGTCACTTT pLKO.1 1831 CDS 100% 4.950 2.970 N OSBPL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.