Transcript: Human XM_006711165.3

PREDICTED: Homo sapiens spermatogenesis associated 17 (SPATA17), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA17 (128153)
Length:
1356
CDS:
47..1081

Additional Resources:

NCBI RefSeq record:
XM_006711165.3
NBCI Gene record:
SPATA17 (128153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242802 CCGAGATATCACCGAAGTATT pLKO_005 727 CDS 100% 13.200 18.480 N SPATA17 n/a
2 TRCN0000242804 ATGTCAAGTTCGGGCATATAT pLKO_005 181 CDS 100% 15.000 10.500 N SPATA17 n/a
3 TRCN0000242803 TGAAATTCTACCACCTATTAA pLKO_005 682 CDS 100% 15.000 10.500 N SPATA17 n/a
4 TRCN0000242800 CAGACTGTATTACCATCATTT pLKO_005 1007 CDS 100% 13.200 9.240 N SPATA17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04835 pDONR223 100% 95.1% 95.2% None 239_240ins51;531G>A n/a
2 ccsbBroad304_04835 pLX_304 0% 95.1% 95.2% V5 239_240ins51;531G>A n/a
3 TRCN0000473251 ATTGTCGATTTCGCCATGACTACC pLX_317 48.3% 95.1% 95.2% V5 239_240ins51;531G>A n/a
Download CSV