Transcript: Human XM_006711349.2

PREDICTED: Homo sapiens zinc finger and BTB domain containing 7B (ZBTB7B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB7B (51043)
Length:
3741
CDS:
284..1903

Additional Resources:

NCBI RefSeq record:
XM_006711349.2
NBCI Gene record:
ZBTB7B (51043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431793 TCGCTGCTTGCATGGAGATTC pLKO_005 684 CDS 100% 10.800 15.120 N ZBTB7B n/a
2 TRCN0000438222 CCAGAGCTACGAACCCTATGA pLKO_005 1084 CDS 100% 4.950 6.930 N ZBTB7B n/a
3 TRCN0000020208 GAAGAAGAGGAGCTGGTATAT pLKO.1 1115 CDS 100% 13.200 9.240 N ZBTB7B n/a
4 TRCN0000416438 GAGTAGAAGCAATAATGTATT pLKO_005 2185 3UTR 100% 13.200 9.240 N ZBTB7B n/a
5 TRCN0000020204 CCCTCCTTGAATTTGCCTATA pLKO.1 585 CDS 100% 10.800 7.560 N ZBTB7B n/a
6 TRCN0000240692 CTGGGCCTCATCTTAGCATTT pLKO_005 3511 3UTR 100% 10.800 7.560 N Zbtb7b n/a
7 TRCN0000437978 CCGGAAAGCTTTCCTGCAAAC pLKO_005 895 CDS 100% 6.000 4.200 N ZBTB7B n/a
8 TRCN0000020206 CCGCCTCTCTCTAGCTCGATT pLKO.1 1765 CDS 100% 1.650 1.155 N ZBTB7B n/a
9 TRCN0000020205 CGCCAGTATCTGGAGGCCTTT pLKO.1 761 CDS 100% 1.350 0.945 N ZBTB7B n/a
10 TRCN0000020207 CCTGACCTGATGGCCTACCTA pLKO.1 1217 CDS 100% 1.000 0.700 N ZBTB7B n/a
11 TRCN0000437332 GTGTGTGTGAGCTGGACTTTG pLKO_005 543 CDS 100% 10.800 6.480 N ZBTB7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08202 pDONR223 100% 99.8% 100% None 390C>T;1416A>G n/a
2 ccsbBroad304_08202 pLX_304 0% 99.8% 100% V5 390C>T;1416A>G n/a
Download CSV