Transcript: Human XM_006711376.1

PREDICTED: Homo sapiens SUN domain containing ossification factor (SUCO), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUCO (51430)
Length:
5606
CDS:
400..4032

Additional Resources:

NCBI RefSeq record:
XM_006711376.1
NBCI Gene record:
SUCO (51430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339419 TCTTGCACCTTCCCATATTTA pLKO_005 4374 3UTR 100% 15.000 21.000 N Suco n/a
2 TRCN0000236260 CCATAGCCAATGGCGACATAA pLKO_005 3653 CDS 100% 13.200 18.480 N SUCO n/a
3 TRCN0000236259 GGTTGAGTTGCTATCACATTT pLKO_005 1551 CDS 100% 13.200 18.480 N SUCO n/a
4 TRCN0000236257 TAAGGACAATGGTAGACATTT pLKO_005 4237 3UTR 100% 13.200 18.480 N SUCO n/a
5 TRCN0000062698 GCGTCATCATATTACTCTCAA pLKO.1 508 CDS 100% 4.950 6.930 N SUCO n/a
6 TRCN0000236261 ATGATTATCCACTGGATTATA pLKO_005 1697 CDS 100% 15.000 12.000 N SUCO n/a
7 TRCN0000062701 CCAGAAGATATACCAACATTT pLKO.1 1081 CDS 100% 13.200 9.240 N SUCO n/a
8 TRCN0000236258 TTAAGCCTTATAAGGGTATTT pLKO_005 1594 CDS 100% 13.200 9.240 N SUCO n/a
9 TRCN0000062699 CCGTGGGAACATTTGGTGTTA pLKO.1 3989 CDS 100% 4.950 3.465 N SUCO n/a
10 TRCN0000062700 CCTTACTACTTCCTGCGGAAT pLKO.1 2261 CDS 100% 4.050 2.835 N SUCO n/a
11 TRCN0000062702 GCAGAATTGAAACGGGAGGTT pLKO.1 3268 CDS 100% 2.640 1.848 N SUCO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.