Transcript: Human XM_006711472.4

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type C (PTPRC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRC (5788)
Length:
5017
CDS:
139..3915

Additional Resources:

NCBI RefSeq record:
XM_006711472.4
NBCI Gene record:
PTPRC (5788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002848 GCAGGGTCAAACTACATAAAT pLKO.1 2101 CDS 100% 15.000 21.000 N PTPRC n/a
2 TRCN0000230686 GAATTGCGATTTCCGTGTAAA pLKO_005 1599 CDS 100% 13.200 18.480 N PTPRC n/a
3 TRCN0000230684 TGAACCCGAACATGAGTATAA pLKO_005 1071 CDS 100% 13.200 18.480 N PTPRC n/a
4 TRCN0000002849 GCTCGATTATTCCCTGTACAA pLKO.1 4636 3UTR 100% 4.950 6.930 N PTPRC n/a
5 TRCN0000230687 CTCCTTGTTCTACTCATATAT pLKO_005 4396 3UTR 100% 15.000 10.500 N PTPRC n/a
6 TRCN0000230685 GACTCAGAAATACTCTATAAT pLKO_005 1096 CDS 100% 15.000 10.500 N PTPRC n/a
7 TRCN0000002845 GCTGCACATCAAGGAGTAATT pLKO.1 1204 CDS 100% 13.200 9.240 N PTPRC n/a
8 TRCN0000218322 TATAACAGAGTGCCACTTAAA pLKO_005 2938 CDS 100% 13.200 9.240 N PTPRC n/a
9 TRCN0000002846 CCAGACAATACTTCCACCCAA pLKO.1 370 CDS 100% 2.640 1.848 N PTPRC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.