Transcript: Human XM_006711800.4

PREDICTED: Homo sapiens regulator of G protein signaling 7 (RGS7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS7 (6000)
Length:
2458
CDS:
397..1806

Additional Resources:

NCBI RefSeq record:
XM_006711800.4
NBCI Gene record:
RGS7 (6000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711800.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014324 CGGAAGTCTGTCTATGGTTTA pLKO.1 997 CDS 100% 10.800 8.640 N RGS7 n/a
2 TRCN0000418557 GCATGAGCAAAGGACCTAAAT pLKO_005 1962 3UTR 100% 13.200 9.240 N RGS7 n/a
3 TRCN0000414540 TCCGCACAGAAAGTTTCATTT pLKO_005 2287 3UTR 100% 13.200 9.240 N RGS7 n/a
4 TRCN0000014325 CCTGGACGATACACATTTGAA pLKO.1 1558 CDS 100% 5.625 3.938 N RGS7 n/a
5 TRCN0000014326 CCTCCAACAGAAGATGAGTTA pLKO.1 1072 CDS 100% 4.950 3.465 N RGS7 n/a
6 TRCN0000014323 GCACACACTTTGTAGCTCAAT pLKO.1 1903 3UTR 100% 4.950 3.465 N RGS7 n/a
7 TRCN0000014327 CCCAGTGCTATTAACTTGGAT pLKO.1 1498 CDS 100% 3.000 2.100 N RGS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711800.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06863 pDONR223 100% 90.3% 89.9% None (many diffs) n/a
2 ccsbBroad304_06863 pLX_304 0% 90.3% 89.9% V5 (many diffs) n/a
Download CSV