Transcript: Human XM_006711987.1

PREDICTED: Homo sapiens intraflagellar transport 172 (IFT172), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IFT172 (26160)
Length:
5265
CDS:
56..5206

Additional Resources:

NCBI RefSeq record:
XM_006711987.1
NBCI Gene record:
IFT172 (26160)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136635 GCAGACAATTGCTCCTTTGAA pLKO.1 3416 CDS 100% 5.625 7.875 N IFT172 n/a
2 TRCN0000137024 CCAACGTAATATGGAAGTCGT pLKO.1 4039 CDS 100% 2.640 3.696 N IFT172 n/a
3 TRCN0000136560 CGGCAGAATACATCATTGTCT pLKO.1 417 CDS 100% 3.000 2.400 N IFT172 n/a
4 TRCN0000079816 CCAGTGGAAGAAGGCAATTTA pLKO.1 2737 CDS 100% 15.000 10.500 N Ift172 n/a
5 TRCN0000325867 CCAGTGGAAGAAGGCAATTTA pLKO_005 2737 CDS 100% 15.000 10.500 N Ift172 n/a
6 TRCN0000136890 CATAGGACAGACTGACAACAT pLKO.1 301 CDS 100% 4.950 3.465 N IFT172 n/a
7 TRCN0000137970 GAACATGGAGAACGGAGAGAT pLKO.1 188 CDS 100% 4.950 3.465 N IFT172 n/a
8 TRCN0000137930 GAAGGCTGCTAACAAGGACAA pLKO.1 5068 CDS 100% 4.050 2.835 N IFT172 n/a
9 TRCN0000137744 GCCTTCTATGAAGCAGGCATT pLKO.1 4781 CDS 100% 4.050 2.835 N IFT172 n/a
10 TRCN0000138950 GCCTTCTTAGAGACTCTGGAA pLKO.1 1892 CDS 100% 2.640 1.848 N IFT172 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.