Transcript: Human XM_006712201.3

PREDICTED: Homo sapiens NCK associated protein 1 (NCKAP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCKAP1 (10787)
Length:
4449
CDS:
254..3634

Additional Resources:

NCBI RefSeq record:
XM_006712201.3
NBCI Gene record:
NCKAP1 (10787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712201.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155763 CCGACACTATGCCTTGTGAAT pLKO.1 981 CDS 100% 4.950 6.930 N NCKAP1 n/a
2 TRCN0000319139 CCGACACTATGCCTTGTGAAT pLKO_005 981 CDS 100% 4.950 6.930 N NCKAP1 n/a
3 TRCN0000152104 CTTAAAGAATTTCTGGCGCTT pLKO.1 3410 CDS 100% 2.160 3.024 N NCKAP1 n/a
4 TRCN0000151941 CCTCTCAATCAAGATACTCAA pLKO.1 1926 CDS 100% 4.950 3.960 N NCKAP1 n/a
5 TRCN0000319140 CCTCTCAATCAAGATACTCAA pLKO_005 1926 CDS 100% 4.950 3.960 N NCKAP1 n/a
6 TRCN0000154905 GCACAGAGAAAGACGCAAGTT pLKO.1 1261 CDS 100% 4.950 3.465 N NCKAP1 n/a
7 TRCN0000349668 GCACAGAGAAAGACGCAAGTT pLKO_005 1261 CDS 100% 4.950 3.465 N NCKAP1 n/a
8 TRCN0000155526 GCAGAGGTATTACGTGCAGTA pLKO.1 1525 CDS 100% 4.050 2.835 N NCKAP1 n/a
9 TRCN0000319212 GCAGAGGTATTACGTGCAGTA pLKO_005 1525 CDS 100% 4.050 2.835 N NCKAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712201.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.