Transcript: Human XM_006712682.3

PREDICTED: Homo sapiens sodium voltage-gated channel alpha subunit 7 (SCN7A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCN7A (6332)
Length:
7605
CDS:
550..5598

Additional Resources:

NCBI RefSeq record:
XM_006712682.3
NBCI Gene record:
SCN7A (6332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712682.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428824 ACCAGTACCTCGCCCATTAAA pLKO_005 4242 CDS 100% 15.000 21.000 N SCN7A n/a
2 TRCN0000044470 CCCATTATACTGGTATAAGTT pLKO.1 1962 CDS 100% 0.563 0.788 N SCN7A n/a
3 TRCN0000421724 GAGTTTGTCCATAGGATTATA pLKO_005 2035 CDS 100% 15.000 12.000 N SCN7A n/a
4 TRCN0000435731 ATGGCTCTTCTTCGATTATTC pLKO_005 2323 CDS 100% 13.200 10.560 N SCN7A n/a
5 TRCN0000425658 TAACTGTGTTTGAGGTTATTA pLKO_005 1109 CDS 100% 15.000 10.500 N SCN7A n/a
6 TRCN0000422908 ATTTGCCCTATTTCGGTTAAT pLKO_005 1578 CDS 100% 13.200 9.240 N SCN7A n/a
7 TRCN0000044472 CCATCATTCAACGTGCTTATA pLKO.1 5438 CDS 100% 13.200 9.240 N SCN7A n/a
8 TRCN0000044469 GCTGACATGATCTTTACTTAT pLKO.1 3460 CDS 100% 13.200 9.240 N SCN7A n/a
9 TRCN0000044471 CCTGATTGATTGCGTATTCAT pLKO.1 933 CDS 100% 5.625 3.938 N SCN7A n/a
10 TRCN0000044468 CCCAGCATTATTGAACATCAT pLKO.1 4680 CDS 100% 4.950 3.465 N SCN7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712682.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.