Transcript: Human XM_006713068.2

PREDICTED: Homo sapiens glycerol-3-phosphate dehydrogenase 1 like (GPD1L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPD1L (23171)
Length:
3799
CDS:
80..994

Additional Resources:

NCBI RefSeq record:
XM_006713068.2
NBCI Gene record:
GPD1L (23171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294229 CCACACAATCGTAGCTTATAA pLKO_005 1285 3UTR 100% 15.000 21.000 N GPD1L n/a
2 TRCN0000036559 CGGCAGCAAAGTAATGGAGAA pLKO.1 442 CDS 100% 4.050 3.240 N GPD1L n/a
3 TRCN0000311685 CGGCAGCAAAGTAATGGAGAA pLKO_005 442 CDS 100% 4.050 3.240 N GPD1L n/a
4 TRCN0000294230 TCCGTGAGAAGATGGGTATTG pLKO_005 351 CDS 100% 10.800 7.560 N GPD1L n/a
5 TRCN0000036561 CTGGACAAGTTTCCATTGTTT pLKO.1 890 CDS 100% 5.625 3.938 N GPD1L n/a
6 TRCN0000182050 CTGCAGTGTATCAGATCTGCT pLKO.1 912 CDS 100% 2.640 1.848 N Gpd1l n/a
7 TRCN0000036563 GCAGACTTCTGCTGAAGTGTA pLKO.1 844 CDS 100% 0.495 0.347 N GPD1L n/a
8 TRCN0000286768 GCAGACTTCTGCTGAAGTGTA pLKO_005 844 CDS 100% 0.495 0.347 N GPD1L n/a
9 TRCN0000178093 GCAGTGTATCAGATCTGCTAT pLKO.1 914 CDS 100% 4.950 3.465 N Gpd1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.