Transcript: Human XM_006713082.3

PREDICTED: Homo sapiens cell adhesion molecule 2 (CADM2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CADM2 (253559)
Length:
9444
CDS:
620..1807

Additional Resources:

NCBI RefSeq record:
XM_006713082.3
NBCI Gene record:
CADM2 (253559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435446 CATCGTCTGCTACCCTTATTA pLKO_005 1890 3UTR 100% 15.000 21.000 N CADM2 n/a
2 TRCN0000421366 GGTTAGAGGTTTACAATTAAT pLKO_005 2256 3UTR 100% 15.000 12.000 N CADM2 n/a
3 TRCN0000416482 ATCATCTCCTTGGATCATTAT pLKO_005 2083 3UTR 100% 13.200 9.240 N CADM2 n/a
4 TRCN0000125351 GCTGATATAAGATGGTTCAAA pLKO.1 1082 CDS 100% 5.625 3.938 N Cadm2 n/a
5 TRCN0000151122 GTAGGGAGCTAAACATTCTTT pLKO.1 1452 CDS 100% 5.625 3.938 N CADM2 n/a
6 TRCN0000155403 CCAAGTCAATGCTGAAGAGAA pLKO.1 1768 CDS 100% 4.950 3.465 N CADM2 n/a
7 TRCN0000125349 CCATCCATAATGCAGGACATT pLKO.1 1990 3UTR 100% 4.950 3.465 N Cadm2 n/a
8 TRCN0000157642 CCATGCTCTCATAGGAGGAAT pLKO.1 1597 CDS 100% 4.950 3.465 N CADM2 n/a
9 TRCN0000155112 GCAAGGCATAAAGGAACGTAT pLKO.1 1676 CDS 100% 4.950 3.465 N CADM2 n/a
10 TRCN0000154981 GCAGTTTCCACTAACACAGAA pLKO.1 691 CDS 100% 4.950 3.465 N CADM2 n/a
11 TRCN0000152037 CTGTGTTCTATCTTTCTGCTT pLKO.1 1643 CDS 100% 2.640 1.848 N CADM2 n/a
12 TRCN0000157167 GACAATAGGATCGAGCTGGTT pLKO.1 839 CDS 100% 2.640 1.848 N CADM2 n/a
13 TRCN0000125352 GCCATGCAGGTGCTAGAAATT pLKO.1 1268 CDS 100% 13.200 9.240 N Cadm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.