Transcript: Human XM_006713778.3

PREDICTED: Homo sapiens spermatogenesis associated 16 (SPATA16), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA16 (83893)
Length:
1919
CDS:
133..1755

Additional Resources:

NCBI RefSeq record:
XM_006713778.3
NBCI Gene record:
SPATA16 (83893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713778.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424697 AGCAGTCCCAGGTGATTAATC pLKO_005 1550 CDS 100% 13.200 18.480 N SPATA16 n/a
2 TRCN0000138134 GATGCTATGGACACCCTTGAA pLKO.1 1654 CDS 100% 4.950 6.930 N SPATA16 n/a
3 TRCN0000137295 GAGCTGAATCTTTCTCGGTTA pLKO.1 1091 CDS 100% 4.050 5.670 N SPATA16 n/a
4 TRCN0000137126 CCTCAGATTGACAAATGGCTT pLKO.1 640 CDS 100% 2.640 3.696 N SPATA16 n/a
5 TRCN0000422859 GCATAAGCAAGCTCATCAAAC pLKO_005 1034 CDS 100% 10.800 7.560 N SPATA16 n/a
6 TRCN0000134587 GCAGAGTATATGTACACAGAT pLKO.1 1195 CDS 100% 4.950 3.465 N SPATA16 n/a
7 TRCN0000137396 GAGAAGATACAGTGAGGCAAA pLKO.1 1388 CDS 100% 4.050 2.835 N SPATA16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713778.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.