Transcript: Human XM_006713815.3

PREDICTED: Homo sapiens kalirin RhoGEF kinase (KALRN), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KALRN (8997)
Length:
6786
CDS:
400..5397

Additional Resources:

NCBI RefSeq record:
XM_006713815.3
NBCI Gene record:
KALRN (8997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234366 GCGGAAACTCGTGACGTATTT pLKO_005 627 CDS 100% 13.200 18.480 N KALRN n/a
2 TRCN0000048211 GCTCAGAATACGTACACCAAT pLKO.1 2164 CDS 100% 4.950 6.930 N KALRN n/a
3 TRCN0000218040 ACATGAGTGAAGAGGTTAATT pLKO_005 5760 3UTR 100% 15.000 10.500 N KALRN n/a
4 TRCN0000048208 CCCGGAAGAAAGAATTTATTA pLKO.1 4241 CDS 100% 15.000 10.500 N KALRN n/a
5 TRCN0000234368 CTTCAGGACACACGAAATATG pLKO_005 4946 CDS 100% 13.200 9.240 N KALRN n/a
6 TRCN0000234369 TGATTCAAGAAAGGATCATTC pLKO_005 5138 CDS 100% 10.800 7.560 N KALRN n/a
7 TRCN0000048210 CCTGTCCAAAGGATCACCAAA pLKO.1 4645 CDS 100% 4.950 3.465 N KALRN n/a
8 TRCN0000048212 GCATATCATCTTTGGCAACAT pLKO.1 4383 CDS 100% 4.950 3.465 N KALRN n/a
9 TRCN0000048209 GCCATGAACAACATGACCTTT pLKO.1 2863 CDS 100% 4.950 3.465 N KALRN n/a
10 TRCN0000234367 GGACCTGGAGCTGGATATTAT pLKO_005 4143 CDS 100% 15.000 9.000 N KALRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.