Transcript: Human XM_006714663.2

PREDICTED: Homo sapiens semaphorin 6A (SEMA6A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA6A (57556)
Length:
6669
CDS:
453..3611

Additional Resources:

NCBI RefSeq record:
XM_006714663.2
NBCI Gene record:
SEMA6A (57556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414449 TTGCTGCTAGGGACCATATTT pLKO_005 661 CDS 100% 15.000 21.000 N SEMA6A n/a
2 TRCN0000431585 GTATTTCGCATGGCAACTATA pLKO_005 535 CDS 100% 13.200 18.480 N SEMA6A n/a
3 TRCN0000061112 CCCTGATGATACCCTGAACTT pLKO.1 1604 CDS 100% 4.950 6.930 N SEMA6A n/a
4 TRCN0000112317 GCCTATGACATGCTTGACATT pLKO.1 1437 CDS 100% 4.950 6.930 N Sema6a n/a
5 TRCN0000061109 CCTGAGAACAATGGTCAGATA pLKO.1 1685 CDS 100% 4.950 3.465 N SEMA6A n/a
6 TRCN0000061108 CGGAGATTATATCTACTTCTT pLKO.1 1136 CDS 100% 4.950 3.465 N SEMA6A n/a
7 TRCN0000061110 GCAGAAACTATAAGATGGATA pLKO.1 883 CDS 100% 4.950 3.465 N SEMA6A n/a
8 TRCN0000061111 GCAGTCATTTACCGGAGTCTT pLKO.1 1035 CDS 100% 4.950 3.465 N SEMA6A n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3938 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714663.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.