Transcript: Human XM_006716085.3

PREDICTED: Homo sapiens zinc finger protein 862 (ZNF862), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF862 (643641)
Length:
6918
CDS:
172..3723

Additional Resources:

NCBI RefSeq record:
XM_006716085.3
NBCI Gene record:
ZNF862 (643641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262284 GCAGTTCCCATGGTTAGTAAT pLKO_005 1626 CDS 100% 13.200 18.480 N ZNF862 n/a
2 TRCN0000262287 CGATCTTCCTTCCACCTAAAG pLKO_005 4978 3UTR 100% 10.800 15.120 N ZNF862 n/a
3 TRCN0000262285 GACCTAATCTCCATGATAAAT pLKO_005 1691 CDS 100% 15.000 10.500 N ZNF862 n/a
4 TRCN0000282170 CTCAACCTGGCCAGGTATTTC pLKO_005 3121 CDS 100% 13.200 9.240 N ZNF862 n/a
5 TRCN0000262286 GACAAACGGTCAAGACTAATA pLKO_005 727 CDS 100% 13.200 9.240 N ZNF862 n/a
6 TRCN0000020998 CGGCTTCCACTTTGTCAAGTT pLKO.1 2712 CDS 100% 4.950 3.465 N SSPO n/a
7 TRCN0000020996 GCCCACATGTTCTGTGTCAAT pLKO.1 805 CDS 100% 4.950 3.465 N SSPO n/a
8 TRCN0000020997 GCATTTCAGATTTGAGGCAAA pLKO.1 1055 CDS 100% 4.050 2.835 N SSPO n/a
9 TRCN0000020994 CCATGATAAATCATCTCGGTT pLKO.1 1701 CDS 100% 2.640 1.848 N SSPO n/a
10 TRCN0000020995 GCTGAAGAACATGGAGGTGTT pLKO.1 3042 CDS 100% 4.050 2.430 N SSPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.