Transcript: Human XM_006716700.2

PREDICTED: Homo sapiens MTSS I-BAR domain containing 1 (MTSS1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTSS1 (9788)
Length:
5268
CDS:
457..3060

Additional Resources:

NCBI RefSeq record:
XM_006716700.2
NBCI Gene record:
MTSS1 (9788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412415 TGATCCATTCCACTCTATAAT pLKO_005 3121 3UTR 100% 15.000 21.000 N MTSS1 n/a
2 TRCN0000416018 TTGTAGGCAACTCGGAATATA pLKO_005 3155 3UTR 100% 15.000 21.000 N MTSS1 n/a
3 TRCN0000059051 CCTTCCAGACTACGCTCATTA pLKO.1 1623 CDS 100% 13.200 18.480 N MTSS1 n/a
4 TRCN0000413177 TTCGAGCGCTTTAATTGATTG pLKO_005 744 CDS 100% 10.800 15.120 N MTSS1 n/a
5 TRCN0000418287 GGGAACCACGAAGTAGTTAAT pLKO_005 3391 3UTR 100% 13.200 10.560 N MTSS1 n/a
6 TRCN0000059050 CCCATGACTCAGGATTCATAT pLKO.1 1421 CDS 100% 13.200 9.240 N MTSS1 n/a
7 TRCN0000059052 CTATCCAGTTTGGGAAGATTT pLKO.1 534 CDS 100% 13.200 9.240 N MTSS1 n/a
8 TRCN0000419980 GACCATCTCGGAAGATCTAAA pLKO_005 1128 CDS 100% 13.200 9.240 N MTSS1 n/a
9 TRCN0000430904 GGACTTGAAAGGTTCTGATTA pLKO_005 1203 CDS 100% 13.200 9.240 N MTSS1 n/a
10 TRCN0000440498 AGTCCTCGGATACGCTGAAAC pLKO_005 875 CDS 100% 10.800 7.560 N MTSS1 n/a
11 TRCN0000059048 CGGCCAGTGATTGAAGAAGAA pLKO.1 1075 CDS 100% 4.950 3.465 N MTSS1 n/a
12 TRCN0000435595 TGTCAATGATAAGTATCTCTT pLKO_005 972 CDS 100% 4.950 3.465 N MTSS1 n/a
13 TRCN0000059049 GCTGGATAAAGACCACGCAAA pLKO.1 819 CDS 100% 4.050 2.835 N MTSS1 n/a
14 TRCN0000447397 TGACCATGGACCCTCACAAAC pLKO_005 1154 CDS 100% 10.800 6.480 N MTSS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.