Transcript: Human XM_006717251.2

PREDICTED: Homo sapiens spectrin alpha, non-erythrocytic 1 (SPTAN1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTAN1 (6709)
Length:
7808
CDS:
137..7573

Additional Resources:

NCBI RefSeq record:
XM_006717251.2
NBCI Gene record:
SPTAN1 (6709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053672 GCTCTAAACACAGACAATTAT pLKO.1 3839 CDS 100% 15.000 10.500 N SPTAN1 n/a
2 TRCN0000299161 GCTCTAAACACAGACAATTAT pLKO_005 3839 CDS 100% 15.000 10.500 N SPTAN1 n/a
3 TRCN0000053669 GCCACTGAACTGAAAGGAATA pLKO.1 2132 CDS 100% 10.800 7.560 N SPTAN1 n/a
4 TRCN0000299159 GCCACTGAACTGAAAGGAATA pLKO_005 2132 CDS 100% 10.800 7.560 N SPTAN1 n/a
5 TRCN0000053671 GACCTCATTAAGAAGAACAAT pLKO.1 5894 CDS 100% 5.625 3.938 N SPTAN1 n/a
6 TRCN0000053670 GCCATTGTTAAGCTGGATGAA pLKO.1 428 CDS 100% 4.950 3.465 N SPTAN1 n/a
7 TRCN0000299160 GCCATTGTTAAGCTGGATGAA pLKO_005 428 CDS 100% 4.950 3.465 N SPTAN1 n/a
8 TRCN0000053668 GCCCATGAAGACAGCTTCAAA pLKO.1 1370 CDS 100% 0.563 0.394 N SPTAN1 n/a
9 TRCN0000299209 GCCCATGAAGACAGCTTCAAA pLKO_005 1370 CDS 100% 0.563 0.394 N SPTAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.