Transcript: Human XM_006717630.3

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 2 (ABCC2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC2 (1244)
Length:
6303
CDS:
252..4193

Additional Resources:

NCBI RefSeq record:
XM_006717630.3
NBCI Gene record:
ABCC2 (1244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717630.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059304 CCTGGTGGATAGCAACAATAT pLKO.1 1253 CDS 100% 13.200 9.240 N ABCC2 n/a
2 TRCN0000289639 CCTGGTGGATAGCAACAATAT pLKO_005 1253 CDS 100% 13.200 9.240 N ABCC2 n/a
3 TRCN0000059306 GCCGGTGGTCAGATTATCATT pLKO.1 3615 CDS 100% 5.625 3.938 N ABCC2 n/a
4 TRCN0000307093 GCCGGTGGTCAGATTATCATT pLKO_005 3615 CDS 100% 5.625 3.938 N ABCC2 n/a
5 TRCN0000059305 GCATCTGAAGTCCCTGAGAAA pLKO.1 2321 CDS 100% 4.950 3.465 N ABCC2 n/a
6 TRCN0000289638 GCATCTGAAGTCCCTGAGAAA pLKO_005 2321 CDS 100% 4.950 3.465 N ABCC2 n/a
7 TRCN0000308184 GTGCTTGTAATCCCAATTAAT pLKO_005 966 CDS 100% 15.000 9.000 N ABCC2 n/a
8 TRCN0000294063 AGACCACAATCCTGTACAAAC pLKO_005 5289 3UTR 100% 10.800 5.400 Y ARF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717630.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.