Transcript: Human XM_006719040.3

PREDICTED: Homo sapiens DENN domain containing 5B (DENND5B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND5B (160518)
Length:
8886
CDS:
123..4013

Additional Resources:

NCBI RefSeq record:
XM_006719040.3
NBCI Gene record:
DENND5B (160518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180116 CGCCCACTATCCTCAGAATAT pLKO.1 368 CDS 100% 13.200 18.480 N DENND5B n/a
2 TRCN0000147648 GCGATACAACTCCTATGATAT pLKO.1 710 CDS 100% 13.200 18.480 N DENND5B n/a
3 TRCN0000146853 CCACCTATACAAGTAGGAAAT pLKO.1 6424 3UTR 100% 10.800 15.120 N DENND5B n/a
4 TRCN0000415538 CCACTATCATGATTCCGTATA pLKO_005 2983 CDS 100% 10.800 15.120 N DENND5B n/a
5 TRCN0000110177 CGGACATCTATATATCAGAAA pLKO.1 2007 CDS 100% 4.950 6.930 N Dennd5b n/a
6 TRCN0000110176 GCGGACATCTATATATCAGAA pLKO.1 2006 CDS 100% 4.950 6.930 N Dennd5b n/a
7 TRCN0000429725 ACACTCGGATTGATAAGATAA pLKO_005 1957 CDS 100% 13.200 10.560 N DENND5B n/a
8 TRCN0000421360 ACGGCAATGTCTGTACTAATA pLKO_005 1489 CDS 100% 13.200 10.560 N DENND5B n/a
9 TRCN0000414289 ATTCGTAGAAGGCTTATTAAA pLKO_005 2390 CDS 100% 15.000 10.500 N DENND5B n/a
10 TRCN0000147699 GCTCTGAGAAATGTGTTCAAT pLKO.1 4694 3UTR 100% 5.625 3.938 N DENND5B n/a
11 TRCN0000146518 CCTGTCTTTGTTAGGGTCTAA pLKO.1 4930 3UTR 100% 4.950 3.465 N DENND5B n/a
12 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 6705 3UTR 100% 5.625 2.813 Y GPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.