Transcript: Human XM_006719529.4

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type B (PTPRB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRB (5787)
Length:
6677
CDS:
525..6563

Additional Resources:

NCBI RefSeq record:
XM_006719529.4
NBCI Gene record:
PTPRB (5787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382161 CCGCAACCGAGTATCGATTTA pLKO_005 3130 CDS 100% 13.200 18.480 N PTPRB n/a
2 TRCN0000381026 TTCGTAGGGATCGACCATTAT pLKO_005 5500 CDS 100% 13.200 18.480 N PTPRB n/a
3 TRCN0000002843 CGGGTGTATCAGACTAATTAT pLKO.1 5088 CDS 100% 15.000 10.500 N PTPRB n/a
4 TRCN0000381060 TCAGCCAGGAGTGACTATTTA pLKO_005 2748 CDS 100% 15.000 10.500 N PTPRB n/a
5 TRCN0000350252 TCGGGTGTATCAGACTAATTA pLKO_005 5087 CDS 100% 15.000 10.500 N PTPRB n/a
6 TRCN0000002842 CCAAGGAATACGAGGAGTTAA pLKO.1 5635 CDS 100% 13.200 9.240 N PTPRB n/a
7 TRCN0000320454 CCAAGGAATACGAGGAGTTAA pLKO_005 5635 CDS 100% 13.200 9.240 N PTPRB n/a
8 TRCN0000002840 CCCGGAGATGTGGATAACTAT pLKO.1 2526 CDS 100% 5.625 3.938 N PTPRB n/a
9 TRCN0000002841 GCCACCACTAAGCAACACAAA pLKO.1 3657 CDS 100% 4.950 3.465 N PTPRB n/a
10 TRCN0000320453 GCCACCACTAAGCAACACAAA pLKO_005 3657 CDS 100% 4.950 3.465 N PTPRB n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6571 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6571 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719529.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11076 pDONR223 100% 24.5% 24.2% None (many diffs) n/a
2 ccsbBroad304_11076 pLX_304 0% 24.5% 24.2% V5 (many diffs) n/a
Download CSV