Transcript: Human XM_006719567.2

PREDICTED: Homo sapiens TBC1 domain family member 15 (TBC1D15), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D15 (64786)
Length:
3077
CDS:
631..1968

Additional Resources:

NCBI RefSeq record:
XM_006719567.2
NBCI Gene record:
TBC1D15 (64786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231962 ATGACCAAGACGGCTTGATTT pLKO_005 237 5UTR 100% 13.200 18.480 N TBC1D15 n/a
2 TRCN0000231963 GCATTAGATTCCTCTAGTATT pLKO_005 323 5UTR 100% 13.200 18.480 N TBC1D15 n/a
3 TRCN0000151278 CGATTGTTAGACAGTGGATTT pLKO.1 1411 CDS 100% 10.800 15.120 N TBC1D15 n/a
4 TRCN0000216709 CTTCGATTATGGGAGGTAATG pLKO.1 1528 CDS 100% 10.800 15.120 N Tbc1d15 n/a
5 TRCN0000155436 CCAGATTCAGACGTTGGTGAA pLKO.1 1804 CDS 100% 4.050 5.670 N TBC1D15 n/a
6 TRCN0000154685 GAGGTAATGTGGACCGAACTA pLKO.1 1540 CDS 100% 4.950 3.960 N TBC1D15 n/a
7 TRCN0000231966 TAAGTGGATTGGCAGTATATT pLKO_005 2530 3UTR 100% 15.000 10.500 N TBC1D15 n/a
8 TRCN0000152199 CCGAACTACCATGTACAAATT pLKO.1 1553 CDS 100% 13.200 9.240 N TBC1D15 n/a
9 TRCN0000231965 TCTAGATATTCTTCGATTATG pLKO_005 1518 CDS 100% 13.200 9.240 N TBC1D15 n/a
10 TRCN0000155787 CAGATACCAGTGTCCTCAGAT pLKO.1 1924 CDS 100% 4.950 3.465 N TBC1D15 n/a
11 TRCN0000150682 GAGATTATGTTCAACCCTGTA pLKO.1 2743 3UTR 100% 4.050 2.835 N TBC1D15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12494 pDONR223 100% 64.3% 64.2% None 0_1ins738;883A>G n/a
2 ccsbBroad304_12494 pLX_304 0% 64.3% 64.2% V5 0_1ins738;883A>G n/a
Download CSV