Transcript: Human XM_006719705.3

PREDICTED: Homo sapiens extra spindle pole bodies like 1, separase (ESPL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESPL1 (9700)
Length:
6690
CDS:
159..6521

Additional Resources:

NCBI RefSeq record:
XM_006719705.3
NBCI Gene record:
ESPL1 (9700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073828 GCTGTCTTATTGATGCTAGAA pLKO.1 6531 3UTR 100% 4.950 6.930 N ESPL1 n/a
2 TRCN0000291193 GCTGTCTTATTGATGCTAGAA pLKO_005 6531 3UTR 100% 4.950 6.930 N ESPL1 n/a
3 TRCN0000073832 CCGCTTCTTACACCAGTAATT pLKO.1 1525 CDS 100% 13.200 10.560 N ESPL1 n/a
4 TRCN0000291192 CCGCTTCTTACACCAGTAATT pLKO_005 1525 CDS 100% 13.200 10.560 N ESPL1 n/a
5 TRCN0000073830 CCTGGTAACTTGGAGGAATTT pLKO.1 2274 CDS 100% 13.200 9.240 N ESPL1 n/a
6 TRCN0000291191 CCTGGTAACTTGGAGGAATTT pLKO_005 2274 CDS 100% 13.200 9.240 N ESPL1 n/a
7 TRCN0000073831 GCTGCTGTACTACCCAACTTT pLKO.1 4000 CDS 100% 5.625 3.938 N ESPL1 n/a
8 TRCN0000291194 GCTGCTGTACTACCCAACTTT pLKO_005 4000 CDS 100% 5.625 3.938 N ESPL1 n/a
9 TRCN0000073829 CCCTGGTAACTTGGAGGAATT pLKO.1 2273 CDS 100% 0.000 0.000 N ESPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.