Transcript: Human XM_006720070.4

PREDICTED: Homo sapiens EMAP like 5 (EML5), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EML5 (161436)
Length:
9629
CDS:
50..5959

Additional Resources:

NCBI RefSeq record:
XM_006720070.4
NBCI Gene record:
EML5 (161436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720070.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412598 ATGATTATCAGTGGGTTATTT pLKO_005 1767 CDS 100% 15.000 21.000 N EML5 n/a
2 TRCN0000417448 CATTAGGACATGGTCATATTT pLKO_005 2943 CDS 100% 15.000 21.000 N EML5 n/a
3 TRCN0000432270 GCTATATGCACTGGGTATAAT pLKO_005 6124 3UTR 100% 15.000 21.000 N EML5 n/a
4 TRCN0000251139 TGGAGTTGCTCAGCGTTATAA pLKO_005 1354 CDS 100% 15.000 21.000 N Eml5 n/a
5 TRCN0000251135 GGTTATGACTGTCGAAGTAAT pLKO_005 2108 CDS 100% 13.200 18.480 N Eml5 n/a
6 TRCN0000413817 GGTTATGACTGTCGAAGTAAT pLKO_005 2108 CDS 100% 13.200 18.480 N EML5 n/a
7 TRCN0000130919 GCTACCATTCAAAGGGAGTAT pLKO.1 4446 CDS 100% 4.950 3.960 N EML5 n/a
8 TRCN0000128148 CCTGGTCATACAGATAGAATA pLKO.1 488 CDS 100% 13.200 9.240 N EML5 n/a
9 TRCN0000128111 CCATCTCTGTAATCGCACATT pLKO.1 6652 3UTR 100% 4.950 3.465 N EML5 n/a
10 TRCN0000129861 GCCATCAGTTTATGTTCAGAT pLKO.1 6630 3UTR 100% 4.950 3.465 N EML5 n/a
11 TRCN0000131085 GCCATCTCTGTAATCGCACAT pLKO.1 6651 3UTR 100% 4.050 2.430 N EML5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720070.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.