Transcript: Human XM_006720996.3

PREDICTED: Homo sapiens nodal modulator 3-like (LOC102723728), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102723728 (102723728)
Length:
1561
CDS:
165..1049

Additional Resources:

NCBI RefSeq record:
XM_006720996.3
NBCI Gene record:
LOC102723728 (102723728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720996.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127484 CCAGTCCCTGTTCTTCCATTT pLKO.1 659 CDS 100% 10.800 5.400 Y NOMO3 n/a
2 TRCN0000430473 CCTCGTGCAATGCAATGAATG pLKO_005 1234 3UTR 100% 10.800 5.400 Y NOMO2 n/a
3 TRCN0000427370 TGTGGTGTGAGAATGTCATTC pLKO_005 1345 3UTR 100% 10.800 5.400 Y NOMO2 n/a
4 TRCN0000128114 CCCTCGTGCAATGCAATGAAT pLKO.1 1233 3UTR 100% 5.625 2.813 Y NOMO3 n/a
5 TRCN0000122198 GCAAAGAGACAAGCCAAGAAA pLKO.1 1008 CDS 100% 5.625 2.813 Y NOMO1 n/a
6 TRCN0000141089 CCAGAAGATGCAAAGAGACAA pLKO.1 999 CDS 100% 4.950 2.475 Y NOMO2 n/a
7 TRCN0000143948 CCATAAACACATCACCTTGAT pLKO.1 791 CDS 100% 4.950 2.475 Y NOMO2 n/a
8 TRCN0000130587 CGAACCGCTTACAGTTGCTAT pLKO.1 252 CDS 100% 4.950 2.475 Y NOMO3 n/a
9 TRCN0000142409 GACTACATCTTGCCTCAAGTT pLKO.1 750 CDS 100% 4.950 2.475 Y NOMO2 n/a
10 TRCN0000130164 CAAACCCATGATGAAGGAGTT pLKO.1 158 5UTR 100% 4.050 2.025 Y NOMO3 n/a
11 TRCN0000139590 CCTTCCTACGTTATGGGTCAA pLKO.1 587 CDS 100% 4.050 2.025 Y NOMO2 n/a
12 TRCN0000139791 CCAGAACCTGAAGATCACCAT pLKO.1 221 CDS 100% 2.640 1.320 Y NOMO2 n/a
13 TRCN0000141757 GCAAGTTCAGATTACGTGGAT pLKO.1 382 CDS 100% 2.640 1.320 Y NOMO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720996.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13680 pDONR223 100% 44.3% 44.3% None 0_1ins1107 n/a
2 ccsbBroad304_13680 pLX_304 0% 44.3% 44.3% V5 0_1ins1107 n/a
Download CSV