Transcript: Human XM_006721184.2

PREDICTED: Homo sapiens ankyrin repeat domain 11 (ANKRD11), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD11 (29123)
Length:
9127
CDS:
574..8268

Additional Resources:

NCBI RefSeq record:
XM_006721184.2
NBCI Gene record:
ANKRD11 (29123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139814 CGGATGCTTACGGAGTTTCTT pLKO.1 4472 CDS 100% 5.625 7.875 N ANKRD11 n/a
2 TRCN0000144209 CCGTATTGAAATGGAGTCAAA pLKO.1 8834 3UTR 100% 4.950 6.930 N ANKRD11 n/a
3 TRCN0000121823 GTTCTTTATCAGACTCCACAA pLKO.1 1964 CDS 100% 4.050 5.670 N ANKRD11 n/a
4 TRCN0000344173 GTTCTTTATCAGACTCCACAA pLKO_005 1964 CDS 100% 4.050 5.670 N ANKRD11 n/a
5 TRCN0000140474 GCCTCTCTCCACAAACCTTTA pLKO.1 5619 CDS 100% 10.800 7.560 N ANKRD11 n/a
6 TRCN0000344118 GCCTCTCTCCACAAACCTTTA pLKO_005 5619 CDS 100% 10.800 7.560 N ANKRD11 n/a
7 TRCN0000122129 GAAGCGAAAGAAAGAAACAAA pLKO.1 1644 CDS 100% 5.625 3.938 N ANKRD11 n/a
8 TRCN0000344172 GAAGCGAAAGAAAGAAACAAA pLKO_005 1644 CDS 100% 5.625 3.938 N ANKRD11 n/a
9 TRCN0000140205 GACGTCAACGACGACTTTGTA pLKO.1 8233 CDS 100% 5.625 3.938 N ANKRD11 n/a
10 TRCN0000140052 CCGCGTGGTTTGTATCTTCTT pLKO.1 8856 3UTR 100% 4.950 3.465 N ANKRD11 n/a
11 TRCN0000344174 CCGCGTGGTTTGTATCTTCTT pLKO_005 8856 3UTR 100% 4.950 3.465 N ANKRD11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.