Transcript: Human XM_006721935.3

PREDICTED: Homo sapiens Rap guanine nucleotide exchange factor like 1 (RAPGEFL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAPGEFL1 (51195)
Length:
3500
CDS:
152..1633

Additional Resources:

NCBI RefSeq record:
XM_006721935.3
NBCI Gene record:
RAPGEFL1 (51195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437647 GACGTTGCCAACCACCTAACT pLKO_005 923 CDS 100% 4.950 6.930 N RAPGEFL1 n/a
2 TRCN0000436513 GGAAAGAGGTCGATGGATTTA pLKO_005 1750 3UTR 100% 13.200 9.240 N RAPGEFL1 n/a
3 TRCN0000446399 GGTGGAGACGGTGGAACTAAA pLKO_005 457 CDS 100% 13.200 9.240 N RAPGEFL1 n/a
4 TRCN0000047581 GTGACGGAGAAACTTCAATAT pLKO.1 677 CDS 100% 13.200 9.240 N RAPGEFL1 n/a
5 TRCN0000429258 ATGAAGGACGAGTCCCTTTAC pLKO_005 398 CDS 100% 10.800 7.560 N RAPGEFL1 n/a
6 TRCN0000047579 CAAGGATCTATACCTGCTAAT pLKO.1 376 CDS 100% 10.800 7.560 N RAPGEFL1 n/a
7 TRCN0000047578 GCCAGGGAAATTCAAGAACTT pLKO.1 1255 CDS 100% 4.950 3.465 N RAPGEFL1 n/a
8 TRCN0000047580 CCTTGTAGATGGTTTGGTGAA pLKO.1 1420 CDS 100% 4.050 2.835 N RAPGEFL1 n/a
9 TRCN0000047582 GAAGGGAGTAAGACCCTTGTA pLKO.1 1406 CDS 100% 0.495 0.347 N RAPGEFL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.