Transcript: Human XM_006722608.3

PREDICTED: Homo sapiens APC regulator of WNT signaling pathway 2 (APC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APC2 (10297)
Length:
10296
CDS:
51..7265

Additional Resources:

NCBI RefSeq record:
XM_006722608.3
NBCI Gene record:
APC2 (10297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413658 ATCAAGCTGTCGCCTACCTAT pLKO_005 3330 CDS 100% 4.950 6.930 N APC2 n/a
2 TRCN0000156823 GAAGCTCTGGTACTACTCTCA pLKO.1 806 CDS 100% 2.640 3.696 N APC2 n/a
3 TRCN0000435494 GGCGACAGCTAACCTTCATCA pLKO_005 6328 CDS 100% 4.950 3.960 N APC2 n/a
4 TRCN0000435617 GTACTGCCCACGCGAACATAT pLKO_005 3158 CDS 100% 13.200 9.240 N APC2 n/a
5 TRCN0000156105 CCAGATGAGGTGAAAGCTTAT pLKO.1 8481 3UTR 100% 10.800 7.560 N APC2 n/a
6 TRCN0000427039 AGGAGAAGCTCTGGTACTACT pLKO_005 802 CDS 100% 4.950 3.465 N APC2 n/a
7 TRCN0000154929 GCTGTTATGAAGCTGTCCTTT pLKO.1 1602 CDS 100% 4.950 3.465 N APC2 n/a
8 TRCN0000156992 GACCTACAAGTGTCAGAGCAA pLKO.1 2108 CDS 100% 2.640 1.848 N APC2 n/a
9 TRCN0000156791 GCAGGTTGACTATGAGATGCA pLKO.1 1685 CDS 100% 2.640 1.848 N APC2 n/a
10 TRCN0000156738 GCGCCAATTCAATTGTCACGT pLKO.1 5428 CDS 100% 2.640 1.848 N APC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722608.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.