Transcript: Human XM_006722711.3

PREDICTED: Homo sapiens MAU2 sister chromatid cohesion factor (MAU2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAU2 (23383)
Length:
1588
CDS:
32..1510

Additional Resources:

NCBI RefSeq record:
XM_006722711.3
NBCI Gene record:
MAU2 (23383)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239285 CCGCAGTTCGAAGATGTTAAA pLKO_005 329 CDS 100% 13.200 18.480 N MAU2 n/a
2 TRCN0000239287 TACAACGAGGCCAAGCGATTT pLKO_005 1458 CDS 100% 10.800 8.640 N MAU2 n/a
3 TRCN0000239286 TGGAGAAGGCGTGGTTGATAT pLKO_005 297 CDS 100% 13.200 9.240 N MAU2 n/a
4 TRCN0000145128 GAAACTCTGAAGATGTCCAAT pLKO.1 1485 CDS 100% 4.950 3.465 N MAU2 n/a
5 TRCN0000140523 GCGAGTGTGTATATACGGGAA pLKO.1 1298 CDS 100% 2.160 1.512 N MAU2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11732 pDONR223 100% 15.5% 8.7% None 1_1182del;1304_1310delAGGTAGT;1476_1477ins367 n/a
2 ccsbBroad304_11732 pLX_304 0% 15.5% 8.7% V5 1_1182del;1304_1310delAGGTAGT;1476_1477ins367 n/a
Download CSV