Transcript: Human XM_006723566.3

PREDICTED: Homo sapiens NK2 homeobox 2 (NKX2-2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NKX2-2 (4821)
Length:
1749
CDS:
228..836

Additional Resources:

NCBI RefSeq record:
XM_006723566.3
NBCI Gene record:
NKX2-2 (4821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436568 GTTTGTGTGAGTAGCGATATT pLKO_005 1227 3UTR 100% 13.200 9.240 N NKX2-2 n/a
2 TRCN0000017153 CGCCGTGTTTACAGAATGTTT pLKO.1 1084 3UTR 100% 5.625 3.938 N NKX2-2 n/a
3 TRCN0000017156 CAAACCATGTCACGCGCTCAA pLKO.1 650 CDS 100% 4.050 2.835 N NKX2-2 n/a
4 TRCN0000075354 CATGCAGTACAACGCCCAGTA pLKO.1 746 CDS 100% 4.050 2.835 N Nkx2-2 n/a
5 TRCN0000017154 GCCGACGAGTCACCGGACAAT pLKO.1 336 CDS 100% 0.000 0.000 N NKX2-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.