Transcript: Human XM_006724001.2

PREDICTED: Homo sapiens integrin subunit beta 2 (ITGB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITGB2 (3689)
Length:
2975
CDS:
454..2556

Additional Resources:

NCBI RefSeq record:
XM_006724001.2
NBCI Gene record:
ITGB2 (3689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029640 GCACCCTGATAAGCTGCGAAA pLKO.1 792 CDS 100% 4.050 3.240 N ITGB2 n/a
2 TRCN0000236132 AGGTCGGGAAGCAGCTGATTT pLKO_005 905 CDS 100% 13.200 9.240 N ITGB2 n/a
3 TRCN0000236131 GTGATGGCGTGCAGATCAATG pLKO_005 1445 CDS 100% 10.800 7.560 N ITGB2 n/a
4 TRCN0000236133 TGGACCGCTACCTCATCTATG pLKO_005 2291 CDS 100% 10.800 7.560 N ITGB2 n/a
5 TRCN0000029639 CCATCTCATTAAGAATGCTTA pLKO.1 1305 CDS 100% 4.950 3.465 N ITGB2 n/a
6 TRCN0000029641 CAAGCTGATATACGGGCAGTA pLKO.1 1824 CDS 100% 4.050 2.835 N ITGB2 n/a
7 TRCN0000029642 GCAACGAATTCGACTACCCAT pLKO.1 1133 CDS 100% 0.000 0.000 N ITGB2 n/a
8 TRCN0000236135 TTGAGGATGTCACCAATTAAC pLKO_005 2637 3UTR 100% 13.200 7.920 N ITGB2 n/a
9 TRCN0000029643 GAAACCCAGGAAGACCACAAT pLKO.1 502 CDS 100% 4.950 2.970 N ITGB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06464 pDONR223 100% 90.9% 91% None 0_1ins207;894C>A;1116T>C n/a
2 ccsbBroad304_06464 pLX_304 0% 90.9% 91% V5 0_1ins207;894C>A;1116T>C n/a
Download CSV