Transcript: Human XM_006724499.2

PREDICTED: Homo sapiens DNA polymerase alpha 1, catalytic subunit (POLA1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLA1 (5422)
Length:
5382
CDS:
366..4346

Additional Resources:

NCBI RefSeq record:
XM_006724499.2
NBCI Gene record:
POLA1 (5422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310108 TCGCTGGTTGTGCCGTGAAAT pLKO_005 4321 CDS 100% 13.200 18.480 N POLA1 n/a
2 TRCN0000052955 CGCAATAAAGACAAGAGGAAT pLKO.1 303 5UTR 100% 4.950 6.930 N POLA1 n/a
3 TRCN0000295990 GCCAATTAAACCCGGTCTAAA pLKO_005 4778 3UTR 100% 13.200 10.560 N POLA1 n/a
4 TRCN0000308014 ATATCATTGTGGGTCATAATA pLKO_005 1852 CDS 100% 15.000 10.500 N POLA1 n/a
5 TRCN0000370110 CAGATCATGTGTGAGCTAAAT pLKO_005 2217 CDS 100% 13.200 9.240 N POLA1 n/a
6 TRCN0000377506 GAGCTCAAAGGATTAGATATA pLKO_005 3174 CDS 100% 13.200 9.240 N POLA1 n/a
7 TRCN0000370109 GTGAACCAATAGACGGAATTG pLKO_005 3628 CDS 100% 10.800 7.560 N POLA1 n/a
8 TRCN0000052957 GCCTGCATGAAAGCTACACTT pLKO.1 4074 CDS 100% 4.950 3.465 N POLA1 n/a
9 TRCN0000174228 GCCTGCATGAAAGCTACACTT pLKO.1 4074 CDS 100% 4.950 3.465 N POLA1 n/a
10 TRCN0000331115 GCCTGCATGAAAGCTACACTT pLKO_005 4074 CDS 100% 4.950 3.465 N POLA1 n/a
11 TRCN0000052956 CCAAGCTTAGAAATGGGCATT pLKO.1 2667 CDS 100% 4.050 2.835 N POLA1 n/a
12 TRCN0000174164 CCAAGCTTAGAAATGGGCATT pLKO.1 2667 CDS 100% 4.050 2.835 N POLA1 n/a
13 TRCN0000052953 CCAGCTTGTATCGTTGCAGTA pLKO.1 3871 CDS 100% 4.050 2.835 N POLA1 n/a
14 TRCN0000052954 GCTGGTGAGAAGTATAAATAT pLKO.1 181 5UTR 100% 15.000 9.000 N POLA1 n/a
15 TRCN0000298738 GCTGGTGAGAAGTATAAATAT pLKO_005 181 5UTR 100% 15.000 9.000 N POLA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.