Transcript: Human XM_006724509.4

PREDICTED: Homo sapiens Scm polycomb group protein like 1 (SCML1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCML1 (6322)
Length:
8838
CDS:
6340..7245

Additional Resources:

NCBI RefSeq record:
XM_006724509.4
NBCI Gene record:
SCML1 (6322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724509.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017500 GCATAATTGTCAGCCGTATTA pLKO.1 6822 CDS 100% 13.200 18.480 N SCML1 n/a
2 TRCN0000280364 GCATAATTGTCAGCCGTATTA pLKO_005 6822 CDS 100% 13.200 18.480 N SCML1 n/a
3 TRCN0000017499 GCTACTACATTGACCGACTTA pLKO.1 7199 CDS 100% 4.950 6.930 N SCML1 n/a
4 TRCN0000280418 GCTACTACATTGACCGACTTA pLKO_005 7199 CDS 100% 4.950 6.930 N SCML1 n/a
5 TRCN0000017502 GCATCCACAACACTTACTCAA pLKO.1 6908 CDS 100% 4.950 3.960 N SCML1 n/a
6 TRCN0000280365 GCATCCACAACACTTACTCAA pLKO_005 6908 CDS 100% 4.950 3.960 N SCML1 n/a
7 TRCN0000017501 CCTCTTCAGAAGCCATGAAAT pLKO.1 7095 CDS 100% 13.200 9.240 N SCML1 n/a
8 TRCN0000017498 GCCTTCTTAGTGTGGAATCAT pLKO.1 7295 3UTR 100% 5.625 3.938 N SCML1 n/a
9 TRCN0000280363 GCCTTCTTAGTGTGGAATCAT pLKO_005 7295 3UTR 100% 5.625 3.938 N SCML1 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1739 5UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1739 5UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1737 5UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1737 5UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1737 5UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000157476 GCCAACATGGTGAAACCCAAT pLKO.1 1812 5UTR 100% 4.050 2.025 Y NFASC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724509.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.