Transcript: Human XM_006724582.4

PREDICTED: Homo sapiens IQ motif and Sec7 domain ArfGEF 2 (IQSEC2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQSEC2 (23096)
Length:
5900
CDS:
222..3860

Additional Resources:

NCBI RefSeq record:
XM_006724582.4
NBCI Gene record:
IQSEC2 (23096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724582.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110127 GAAAGGTATGATGCGGCCTAA pLKO.1 3611 CDS 100% 4.050 5.670 N Iqsec2 n/a
2 TRCN0000140363 GAAAGGTATGATGCGGCCTAA pLKO.1 3611 CDS 100% 4.050 5.670 N IQSEC2 n/a
3 TRCN0000144705 GCTGAACGAAAGATGAAACTA pLKO.1 3021 CDS 100% 5.625 4.500 N IQSEC2 n/a
4 TRCN0000141916 CCGCATGAACAAGAACTTTGA pLKO.1 1400 CDS 100% 4.950 3.465 N IQSEC2 n/a
5 TRCN0000139603 CGTACAGTTTCCGTCAGTCTT pLKO.1 3370 CDS 100% 4.950 3.465 N IQSEC2 n/a
6 TRCN0000142648 GCAATTCCAATGAGACCATCA pLKO.1 2425 CDS 100% 4.050 2.835 N IQSEC2 n/a
7 TRCN0000140259 GCAGTTCAACAGAGACGTGTT pLKO.1 2753 CDS 100% 4.050 2.835 N IQSEC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724582.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.