Transcript: Human XM_006724593.3

PREDICTED: Homo sapiens WNK lysine deficient protein kinase 3 (WNK3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WNK3 (65267)
Length:
11110
CDS:
378..5609

Additional Resources:

NCBI RefSeq record:
XM_006724593.3
NBCI Gene record:
WNK3 (65267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219674 AGACCGGGTGACGCCAATAAA pLKO.1 1832 CDS 100% 15.000 21.000 N WNK3 n/a
2 TRCN0000230000 AGACCGGGTGACGCCAATAAA pLKO_005 1832 CDS 100% 15.000 21.000 N WNK3 n/a
3 TRCN0000230001 GAACGCCTTCGGTCAATTAAA pLKO_005 4926 CDS 100% 15.000 21.000 N WNK3 n/a
4 TRCN0000001531 CGGGACACATTGCTCACTATA pLKO.1 3123 CDS 100% 13.200 18.480 N WNK3 n/a
5 TRCN0000218353 GACCTTAAAGACGTACTTAAA pLKO_005 1076 CDS 100% 13.200 18.480 N WNK3 n/a
6 TRCN0000001532 GCAGCTCAAATATACCGGAAA pLKO.1 1437 CDS 100% 4.050 5.670 N WNK3 n/a
7 TRCN0000196566 GAGTTCTGTCTACTAGTAAAC pLKO.1 7332 3UTR 100% 0.000 0.000 N WNK3 n/a
8 TRCN0000355859 CAATCCCTCCTGGTCCTAAAT pLKO_005 5587 CDS 100% 13.200 10.560 N WNK3 n/a
9 TRCN0000195019 CCACTGGAGTTGATTCTATTA pLKO.1 2857 CDS 100% 13.200 10.560 N WNK3 n/a
10 TRCN0000001530 CGGTCAATTAAAGATAGCAAA pLKO.1 4935 CDS 100% 4.950 3.960 N WNK3 n/a
11 TRCN0000230002 ACCCTAGAAGGATACTATTTA pLKO_005 6927 3UTR 100% 15.000 10.500 N WNK3 n/a
12 TRCN0000355860 CAAGTCAGCCTGCTAATATAT pLKO_005 3949 CDS 100% 15.000 10.500 N WNK3 n/a
13 TRCN0000219673 TGTCTATCAGGGACCTATTAA pLKO.1 1558 CDS 100% 15.000 10.500 N WNK3 n/a
14 TRCN0000229999 TGTCTATCAGGGACCTATTAA pLKO_005 1558 CDS 100% 15.000 10.500 N WNK3 n/a
15 TRCN0000378192 AGCTGACTCAGCCGCAGATTT pLKO_005 2281 CDS 100% 13.200 9.240 N WNK3 n/a
16 TRCN0000001533 GCCTCACGTTTGTCAGTATAA pLKO.1 5414 CDS 100% 13.200 9.240 N WNK3 n/a
17 TRCN0000195276 CACATGTTTGTCTTAGGTTTA pLKO.1 6106 3UTR 100% 10.800 7.560 N WNK3 n/a
18 TRCN0000001534 GCAGACTATATGGTTGAAGAT pLKO.1 2733 CDS 100% 4.950 3.465 N WNK3 n/a
19 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 6340 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.