Transcript: Mouse XM_011238384.2

PREDICTED: Mus musculus polycystic kidney and hepatic disease 1 (Pkhd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkhd1 (241035)
Length:
11856
CDS:
255..10466

Additional Resources:

NCBI RefSeq record:
XM_011238384.2
NBCI Gene record:
Pkhd1 (241035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200621 CCTGAGATATTCCTATGATTT pLKO.1 6566 CDS 100% 13.200 18.480 N Pkhd1 n/a
2 TRCN0000191008 CCAGAAATCTTATCCGTGTTT pLKO.1 1023 CDS 100% 4.950 6.930 N Pkhd1 n/a
3 TRCN0000191165 CCTTGTGATATTGTGAACTTA pLKO.1 3954 CDS 100% 5.625 4.500 N Pkhd1 n/a
4 TRCN0000425120 CCGGGAAATGAGAGGATTATT pLKO_005 8865 CDS 100% 15.000 10.500 N Pkhd1 n/a
5 TRCN0000420748 TGGAAGTCTCTTGACGATAAA pLKO_005 5003 CDS 100% 13.200 9.240 N Pkhd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.