Transcript: Mouse XM_011238446.2

PREDICTED: Mus musculus AF4/FMR2 family, member 3 (Aff3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aff3 (16764)
Length:
8462
CDS:
573..4406

Additional Resources:

NCBI RefSeq record:
XM_011238446.2
NBCI Gene record:
Aff3 (16764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226014 TCCTATACTGGCGGATGTTTC pLKO_005 3982 CDS 100% 10.800 15.120 N LOC638024 n/a
2 TRCN0000086611 GCTGGATAAATGGCTAAACAA pLKO.1 2171 CDS 100% 5.625 7.875 N Aff3 n/a
3 TRCN0000226015 CTACTGGGAGATGGCTGATAA pLKO_005 4244 CDS 100% 13.200 10.560 N LOC638024 n/a
4 TRCN0000226013 CACCAGAGGACAAACAGTTAG pLKO_005 3934 CDS 100% 10.800 7.560 N LOC638024 n/a
5 TRCN0000086612 GAACAAGATAGATGAGCATTT pLKO.1 1079 CDS 100% 10.800 7.560 N Aff3 n/a
6 TRCN0000086610 GCAGCTGGATAAATGGCTAAA pLKO.1 2168 CDS 100% 10.800 7.560 N Aff3 n/a
7 TRCN0000086609 CGAAGATGACTACAGGGAGAT pLKO.1 3245 CDS 100% 4.050 2.835 N Aff3 n/a
8 TRCN0000086608 GCTGCTTACAATGCAGGGAAA pLKO.1 5451 3UTR 100% 4.050 2.835 N Aff3 n/a
9 TRCN0000226016 GTTCTTCAATGACCTGGATTT pLKO_005 4286 CDS 100% 10.800 6.480 N LOC638024 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.