Transcript: Mouse XM_011238474.2

PREDICTED: Mus musculus parathyroid hormone 2 receptor (Pth2r), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pth2r (213527)
Length:
2933
CDS:
601..2118

Additional Resources:

NCBI RefSeq record:
XM_011238474.2
NBCI Gene record:
Pth2r (213527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437724 CTGGTATTTGGCGTGCATTAC pLKO_005 1576 CDS 100% 10.800 15.120 N Pth2r n/a
2 TRCN0000027963 GCTAACTATTCAGACTGCTTT pLKO.1 835 CDS 100% 4.950 6.930 N Pth2r n/a
3 TRCN0000418037 CTGACGGCACCATCACTATAG pLKO_005 560 5UTR 100% 10.800 8.640 N Pth2r n/a
4 TRCN0000027981 CGCTGTCGTGATGTTTATTTA pLKO.1 1185 CDS 100% 15.000 10.500 N Pth2r n/a
5 TRCN0000028033 GCTCCGATCTTAGCTGCTATT pLKO.1 1426 CDS 100% 10.800 7.560 N Pth2r n/a
6 TRCN0000027945 CCGTATGTTTACGACTTCAAT pLKO.1 739 CDS 100% 5.625 3.938 N Pth2r n/a
7 TRCN0000027974 CCAGGGTTTCTTCGTGTCTAT pLKO.1 1680 CDS 100% 4.950 3.465 N Pth2r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238474.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.