Transcript: Mouse XM_011238608.2

PREDICTED: Mus musculus zinc finger, DBF-type containing 2 (Zdbf2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdbf2 (73884)
Length:
12391
CDS:
264..7760

Additional Resources:

NCBI RefSeq record:
XM_011238608.2
NBCI Gene record:
Zdbf2 (73884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353265 ACGTCGGACAGCTACTAATAA pLKO_005 368 CDS 100% 15.000 21.000 N Zdbf2 n/a
2 TRCN0000353225 TTAGAGGGATGGCCGTAAATG pLKO_005 3421 CDS 100% 13.200 10.560 N Zdbf2 n/a
3 TRCN0000346105 AGCAACCTTTGTCCCATTTAT pLKO_005 7965 3UTR 100% 15.000 10.500 N Zdbf2 n/a
4 TRCN0000346157 CCCGATTCCTTGGTCTATATT pLKO_005 6222 CDS 100% 15.000 10.500 N Zdbf2 n/a
5 TRCN0000346158 CTGCGACACCACCCATATAAT pLKO_005 420 CDS 100% 15.000 10.500 N Zdbf2 n/a
6 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1437 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.