Transcript: Mouse XM_011238683.2

PREDICTED: Mus musculus dedicator of cytokinesis 10 (Dock10), transcript variant X17, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dock10 (210293)
Length:
7985
CDS:
159..5471

Additional Resources:

NCBI RefSeq record:
XM_011238683.2
NBCI Gene record:
Dock10 (210293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265176 GAGTGGTGCTGAACCTTATAT pLKO_005 173 CDS 100% 15.000 21.000 N Dock10 n/a
2 TRCN0000251514 TTGCCGTCCATACCGAGTATA pLKO_005 605 CDS 100% 13.200 18.480 N Dock10 n/a
3 TRCN0000251515 TACCTAGGGAAACGCAATATA pLKO_005 2754 CDS 100% 0.000 0.000 N Dock10 n/a
4 TRCN0000251516 GTAACGTTTCAGATGTTATAT pLKO_005 7803 3UTR 100% 15.000 10.500 N Dock10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12236 pDONR223 100% 26.2% 28.1% None (many diffs) n/a
2 ccsbBroad304_12236 pLX_304 0% 26.2% 28.1% V5 (many diffs) n/a
3 TRCN0000473559 AACGGTCTGATACTATGCAAGGTC pLX_317 26.1% 26.2% 28.1% V5 (many diffs) n/a
Download CSV