Construct: ORF TRCN0000473559
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015902.1_s317c1
- Derived from:
- ccsbBroadEn_12236
- DNA Barcode:
- AACGGTCTGATACTATGCAAGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DOCK10 (55619)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473559
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | NM_001290263.2 | 24.8% | 24.8% | 1_4914del |
| 2 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | NM_014689.3 | 24.7% | 24.7% | 1_4932del |
| 3 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | NM_001363762.1 | 24.6% | 24.6% | 1_4971del |
| 4 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004446.2 | 23.9% | 23.1% | (many diffs) |
| 5 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004447.1 | 23.6% | 23.2% | 1_4944del;6456_6531del;6591_6592ins55 |
| 6 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004445.2 | 23.5% | 22.8% | (many diffs) |
| 7 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_006712617.4 | 23.5% | 23.1% | 1_4971del;6483_6558del;6618_6619ins55 |
| 8 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004444.2 | 23.5% | 22.8% | (many diffs) |
| 9 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004443.2 | 23.5% | 22.7% | (many diffs) |
| 10 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004442.2 | 23.4% | 22.7% | (many diffs) |
| 11 | human | 55619 | DOCK10 | dedicator of cytokinesis 10 | XM_017004441.2 | 23.3% | 22.6% | (many diffs) |
| 12 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_011238683.2 | 26.2% | 28.1% | (many diffs) |
| 13 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | NM_001285927.1 | 21.8% | 23.8% | (many diffs) |
| 14 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496476.3 | 21.8% | 23.8% | (many diffs) |
| 15 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | NM_175291.4 | 21.7% | 23.6% | (many diffs) |
| 16 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496470.3 | 21.6% | 23.6% | (many diffs) |
| 17 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_017319533.1 | 20.9% | 22.6% | (many diffs) |
| 18 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_017319527.1 | 20.8% | 22.7% | (many diffs) |
| 19 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496473.3 | 20.8% | 22.5% | (many diffs) |
| 20 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_017319532.1 | 20.8% | 22.5% | (many diffs) |
| 21 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496469.3 | 20.8% | 22.7% | (many diffs) |
| 22 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496471.3 | 20.4% | 21.9% | (many diffs) |
| 23 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496466.3 | 20.4% | 21.9% | (many diffs) |
| 24 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496465.3 | 20.4% | 21.8% | (many diffs) |
| 25 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496464.3 | 20.3% | 21.8% | (many diffs) |
| 26 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496463.3 | 20.3% | 21.8% | (many diffs) |
| 27 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_017319519.1 | 20.2% | 21.7% | (many diffs) |
| 28 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496475.3 | 19.5% | 21.5% | (many diffs) |
| 29 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XR_001783679.1 | 19.1% | (many diffs) | |
| 30 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496468.3 | 19.1% | 20.7% | (many diffs) |
| 31 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XM_006496467.3 | 19.1% | 20.6% | (many diffs) |
| 32 | mouse | 210293 | Dock10 | dedicator of cytokinesis 10 | XR_373539.3 | 12.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1692
- ORF length:
- 1626
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa aaacagcaat ttcccagcag aggtgaagga cctgactaag cgtataagga 121 ctgttttgat ggccacagct cagatgaagg agcacgagaa ggaccccgag atgctggtgg 181 atctccagta cagcctggca aactcctacg caagcactcc tgaactacgc aggacctggc 241 tggaaagtat ggccaagatt catgccagaa acggagattt atctgaggct gccatgtgtt 301 acatccatat tgctgctctc attgcagagt atctgaaaag aaagggttac tggaaagtgg 361 aaaagatttg cacagcatcc ctgctctcgg aggataccca cccctgtgat agcaactcat 421 tactaacaac tcccagtgga ggaagcatgt tctctatggg atggccagct tttttgagca 481 ttacaccaaa cattaaggaa gaaggagcga tgaaagagga ttctggaatg caagatacac 541 catacaatga gaatatcctg gtggagcagc tatacatgtg tgtggagttt ctctggaagt 601 ctgagcgata tgaactcatt gctgatgtca acaagcccat cattgctgtc tttgagaaac 661 aacgagactt caaaaaattg tcagatctct actacgacat tcatcggtca tatctgaaag 721 tggcagaggt ggtgaattcg gagaagcggc tgtttggtcg ctactatcgt gtggcatttt 781 atgggcaggg cttttttgaa gaagaagaag gtaaagagta tatttataaa gagcctaagc 841 tgacaggtct gtccgagatt tcccaaagat tactcaagct ctatgcagat aaatttggag 901 cagacaatgt gaagataatc caggattcca acaaggtaaa ccccaaggat ttggacccca 961 aatatgccta catccaggtg acctatgtga cgccgttctt tgaggaaaag gaaatcgaag 1021 accggaagac agatttcgaa atgcaccaca acatcaaccg ctttgtcttc gagacaccct 1081 tcacgctgtc gggcaagaag cacggtgggg tggcggagca gtgcaagcgg cggacgatcc 1141 tgacaacgag tcacctgttc ccctacgtga agaagagaat acaagtaatt agccaatcga 1201 gcacagaact gaatccaatt gaagtggcaa ttgacgagat gtccaagaag gtttctgagc 1261 ttaatcagct ttGCACAATG GAAGAAGTGG ACATGATCAG ACTGCAGCTC AAACTGCAAG 1321 GAAGTGTCAG CGTGAAGGTT AATGCTGGGC CAATGGCCTA TGCACGAGCT TTTCTTGAAG 1381 AAACCAATGC AAAGAAGTAC CCTGACAACC AAGTAAAGCT TTTGAAGGAG ATCTTCAGGC 1441 AATTTGCAGA TGCATGTGGG CAGGCCCTTG ACGTGAATGA GCGCCTCATC AAAGAGGACC 1501 AGCTGGAGTA CCAGGAAGAA CTGAGGTCCC ACTACAAGGA CATGCTCAGC GAACTCTCCA 1561 CAGTCATGAA TGAGCAGATT ACGGGCAGGG ACGACCTGTC AAAGCGCGGA GTGGACCAAA 1621 CCTGCACTCG AGTAATTAGC AAAGCAACTC CGGCCCTACC CACGGTCTCC ATCTCATCTA 1681 GTGCTGAAGT CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1741 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1801 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAAC GGTCTGATAC TATGCAAGGT 1861 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t