Transcript: Mouse XM_011238728.1

PREDICTED: Mus musculus predicted gene, 38510 (Gm38510), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm38510 (102638555)
Length:
1181
CDS:
381..1181

Additional Resources:

NCBI RefSeq record:
XM_011238728.1
NBCI Gene record:
Gm38510 (102638555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271980 CTGCTGTGTTGGCTGGTATTT pLKO_005 642 CDS 100% 13.200 6.600 Y Gm7609 n/a
2 TRCN0000284608 GGGACTTGGACCACGGTTATA pLKO_005 795 CDS 100% 13.200 6.600 Y Gm7609 n/a
3 TRCN0000249699 TGCTGTGTTGGCTGGTATTTG pLKO_005 643 CDS 100% 13.200 6.600 Y Csprs n/a
4 TRCN0000193834 CTTGTTCATCTACTGCAGATA pLKO.1 1050 CDS 100% 4.950 2.475 Y Csprs n/a
5 TRCN0000173867 GATCCTCCTTACTCTGACCTT pLKO.1 689 CDS 100% 2.640 1.320 Y Csprs n/a
6 TRCN0000249703 TACCTACCCTGATAATCATAG pLKO_005 1084 CDS 100% 0.000 0.000 Y Csprs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.