Transcript: Mouse XM_011238938.1

PREDICTED: Mus musculus synaptotagmin XIV (Syt14), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syt14 (329324)
Length:
7645
CDS:
228..1571

Additional Resources:

NCBI RefSeq record:
XM_011238938.1
NBCI Gene record:
Syt14 (329324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093198 ACCTTGTTCTTCTACCTATAA pLKO.1 748 CDS 100% 13.200 18.480 N Syt14 n/a
2 TRCN0000093194 CCACGTTGAATCCGAGATGAT pLKO.1 839 CDS 100% 4.950 3.960 N Syt14 n/a
3 TRCN0000002109 CCTTGTTCTTCTACCTATAAA pLKO.1 749 CDS 100% 15.000 10.500 N SYT14 n/a
4 TRCN0000093195 GCAGTTAGGTTTAGACTATAT pLKO.1 870 CDS 100% 13.200 9.240 N Syt14 n/a
5 TRCN0000380843 GGCCGAGAGCTATCACAATAA pLKO_005 488 CDS 100% 13.200 9.240 N Syt14 n/a
6 TRCN0000093196 GTCACAGACATTCCAACATAT pLKO.1 696 CDS 100% 13.200 9.240 N Syt14 n/a
7 TRCN0000314848 CTTGTTCTTCTACCTATAAAG pLKO_005 750 CDS 100% 13.200 9.240 N SYT14 n/a
8 TRCN0000147941 GAGATGTCCAAATGCAAGATA pLKO.1 1299 CDS 100% 5.625 3.938 N SYT14P1 n/a
9 TRCN0000147682 GACTATCAGCAGAAGTGATAA pLKO.1 1138 CDS 100% 1.320 0.924 N SYT14P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.