Transcript: Mouse XM_011238962.2

PREDICTED: Mus musculus myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10 (Mllt10), transcript variant X17, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mllt10 (17354)
Length:
4236
CDS:
172..3312

Additional Resources:

NCBI RefSeq record:
XM_011238962.2
NBCI Gene record:
Mllt10 (17354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072134 CGACTGTTATTTCACAGCCTA pLKO.1 1277 CDS 100% 2.640 3.696 N Mllt10 n/a
2 TRCN0000072135 CCCATATGTATGGCAGTAGAT pLKO.1 1925 CDS 100% 0.000 0.000 N Mllt10 n/a
3 TRCN0000072136 CCATGTAACATGTGCTCAGTT pLKO.1 435 CDS 100% 4.950 3.465 N Mllt10 n/a
4 TRCN0000072137 CAGCAGTAAGAGCCCACATAT pLKO.1 2442 CDS 100% 13.200 7.920 N Mllt10 n/a
5 TRCN0000234825 GGTAACCAACTGGCAATTAAT pLKO_005 2722 CDS 100% 15.000 10.500 N MLLT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.