Transcript: Mouse XM_011239036.2

PREDICTED: Mus musculus prostaglandin-endoperoxide synthase 1 (Ptgs1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptgs1 (19224)
Length:
4400
CDS:
1668..3476

Additional Resources:

NCBI RefSeq record:
XM_011239036.2
NBCI Gene record:
Ptgs1 (19224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067901 CGATCTGGCTTCGTGAACATA pLKO.1 2581 CDS 100% 5.625 7.875 N Ptgs1 n/a
2 TRCN0000334293 CGATCTGGCTTCGTGAACATA pLKO_005 2581 CDS 100% 5.625 7.875 N Ptgs1 n/a
3 TRCN0000067898 GCAGCACTTGAGTGGCTATTT pLKO.1 2720 CDS 100% 13.200 9.240 N Ptgs1 n/a
4 TRCN0000334227 GCAGCACTTGAGTGGCTATTT pLKO_005 2720 CDS 100% 13.200 9.240 N Ptgs1 n/a
5 TRCN0000067902 CTCGACAACTACCAGTGTGAT pLKO.1 1827 CDS 100% 4.950 3.465 N Ptgs1 n/a
6 TRCN0000067899 GTGAGCTACTATACTCGCATT pLKO.1 2106 CDS 100% 4.050 2.835 N Ptgs1 n/a
7 TRCN0000334226 GTGAGCTACTATACTCGCATT pLKO_005 2106 CDS 100% 4.050 2.835 N Ptgs1 n/a
8 TRCN0000067900 CCCAACTCCATCTTTGGAGAA pLKO.1 3213 CDS 100% 0.405 0.284 N Ptgs1 n/a
9 TRCN0000348237 GATTTGGAATATAGGCTTAAA pLKO_005 3735 3UTR 100% 13.200 7.920 N Ptgs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.