Transcript: Mouse XM_011239064.2

PREDICTED: Mus musculus small nuclear RNA activating complex, polypeptide 4 (Snapc4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snapc4 (227644)
Length:
4464
CDS:
100..4188

Additional Resources:

NCBI RefSeq record:
XM_011239064.2
NBCI Gene record:
Snapc4 (227644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239064.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081531 CTGGGAGAAGATTTCCAATAT pLKO.1 909 CDS 100% 13.200 18.480 N Snapc4 n/a
2 TRCN0000421710 GTCTGACCCTGGCAACAATAC pLKO_005 2220 CDS 100% 10.800 15.120 N Snapc4 n/a
3 TRCN0000081529 GCTAAATTGCTTCAAGCTGTT pLKO.1 1351 CDS 100% 4.050 5.670 N Snapc4 n/a
4 TRCN0000081532 CTCCGGTATTCACACTGCTTA pLKO.1 2471 CDS 100% 4.950 3.960 N Snapc4 n/a
5 TRCN0000234859 GGGAGAAGATTTCCAATATTA pLKO_005 911 CDS 100% 15.000 10.500 N SNAPC4 n/a
6 TRCN0000413447 CGTCTGCTTCAGCCCAAATTG pLKO_005 730 CDS 100% 13.200 9.240 N Snapc4 n/a
7 TRCN0000423904 TCAGCTATTGCAGATTGATAC pLKO_005 2493 CDS 100% 10.800 7.560 N Snapc4 n/a
8 TRCN0000081530 CCACTTCCTGAAGCCATACTT pLKO.1 552 CDS 100% 5.625 3.938 N Snapc4 n/a
9 TRCN0000081528 GCAGTACACAACCCTCAGCAA pLKO.1 4278 3UTR 100% 2.640 1.848 N Snapc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239064.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.