Transcript: Mouse XM_011239139.2

PREDICTED: Mus musculus amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein (Apbb1ip), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Apbb1ip (54519)
Length:
3044
CDS:
983..2995

Additional Resources:

NCBI RefSeq record:
XM_011239139.2
NBCI Gene record:
Apbb1ip (54519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097780 GCCAAAGCAAAGGCTGATAAA pLKO.1 1457 CDS 100% 13.200 18.480 N Apbb1ip n/a
2 TRCN0000097781 GCACTGGAAGACCAAGATTTA pLKO.1 1154 CDS 100% 13.200 10.560 N Apbb1ip n/a
3 TRCN0000097784 CCTGAACTTCTCTCTAAAGAA pLKO.1 1427 CDS 100% 5.625 4.500 N Apbb1ip n/a
4 TRCN0000182813 CGTGGTCTCAAGGTTAAGACT pLKO.1 259 5UTR 100% 3.000 2.100 N 1700092C17Rik n/a
5 TRCN0000097783 CGCTACTTTCTTCTGAGAGCT pLKO.1 1979 CDS 100% 2.640 1.848 N Apbb1ip n/a
6 TRCN0000097782 GCTACTTTCTTCTGAGAGCTT pLKO.1 1980 CDS 100% 2.640 1.848 N Apbb1ip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.