Transcript: Mouse XM_011239204.2

PREDICTED: Mus musculus ADP-ribosylation factor-like 5A (Arl5a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arl5a (75423)
Length:
5224
CDS:
361..789

Additional Resources:

NCBI RefSeq record:
XM_011239204.2
NBCI Gene record:
Arl5a (75423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011945 CCGTTTCCTGATGTGGGATAT pLKO.1 429 CDS 100% 10.800 8.640 N Arl5a n/a
2 TRCN0000344999 CCGTTTCCTGATGTGGGATAT pLKO_005 429 CDS 100% 10.800 8.640 N Arl5a n/a
3 TRCN0000011943 CCCTTCACATTGAATCAAATA pLKO.1 1119 3UTR 100% 13.200 9.240 N Arl5a n/a
4 TRCN0000011947 CGTACACACATCTCCTACAAT pLKO.1 372 CDS 100% 5.625 3.938 N Arl5a n/a
5 TRCN0000345072 CGTACACACATCTCCTACAAT pLKO_005 372 CDS 100% 5.625 3.938 N Arl5a n/a
6 TRCN0000380126 AGAGTTTGTAATAGTTGTTGT pLKO_005 501 CDS 100% 4.950 3.465 N ARL5A n/a
7 TRCN0000011946 CCAAGGACTTGAATGGATGAT pLKO.1 747 CDS 100% 4.950 3.465 N Arl5a n/a
8 TRCN0000345074 CCAAGGACTTGAATGGATGAT pLKO_005 747 CDS 100% 4.950 3.465 N Arl5a n/a
9 TRCN0000011944 GCCAAGAATCACTTCGTCCTT pLKO.1 455 CDS 100% 2.640 1.848 N Arl5a n/a
10 TRCN0000345000 GCCAAGAATCACTTCGTCCTT pLKO_005 455 CDS 100% 2.640 1.848 N Arl5a n/a
11 TRCN0000379806 CAATGCTGGGAAGACGACCTT pLKO_005 324 5UTR 100% 2.640 1.584 N ARFRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.