Transcript: Mouse XM_011239341.2

PREDICTED: Mus musculus myosin binding protein C, cardiac (Mybpc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mybpc3 (17868)
Length:
4205
CDS:
56..3892

Additional Resources:

NCBI RefSeq record:
XM_011239341.2
NBCI Gene record:
Mybpc3 (17868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109464 CGCATAAAGGTGTCCCATATA pLKO.1 1832 CDS 100% 13.200 18.480 N Mybpc3 n/a
2 TRCN0000109463 CGCCAATGACAAGTATGGTTT pLKO.1 229 CDS 100% 4.950 3.960 N Mybpc3 n/a
3 TRCN0000109461 GCTCCATCATTGCAGGCTATA pLKO.1 3636 CDS 100% 10.800 7.560 N Mybpc3 n/a
4 TRCN0000082907 CCACTTCATGGAGGTCAAGAT pLKO.1 1954 CDS 100% 4.950 3.465 N MYBPC3 n/a
5 TRCN0000109460 CTACTGCATGTGTGTGTGCAA pLKO.1 3994 3UTR 100% 2.640 1.584 N Mybpc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.