Transcript: Mouse XM_011239349.2

PREDICTED: Mus musculus NK2 homeobox 2 (Nkx2-2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nkx2-2 (18088)
Length:
2193
CDS:
648..1469

Additional Resources:

NCBI RefSeq record:
XM_011239349.2
NBCI Gene record:
Nkx2-2 (18088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436568 GTTTGTGTGAGTAGCGATATT pLKO_005 1880 3UTR 100% 13.200 18.480 N NKX2-2 n/a
2 TRCN0000075355 GCTGACGAGTCACCGGACAAT pLKO.1 969 CDS 100% 1.650 2.310 N Nkx2-2 n/a
3 TRCN0000075353 CCGCACTGCTTTCGTGAATTT pLKO.1 1849 3UTR 100% 13.200 9.240 N Nkx2-2 n/a
4 TRCN0000424604 TAGAACTCTAAGCCGTGTTTA pLKO_005 1707 3UTR 100% 13.200 9.240 N Nkx2-2 n/a
5 TRCN0000426417 ACCAAACCATCCCAACGTTAA pLKO_005 1776 3UTR 100% 10.800 7.560 N Nkx2-2 n/a
6 TRCN0000432110 TTCCGGACACCAACGATGAAG pLKO_005 700 CDS 100% 4.950 3.465 N Nkx2-2 n/a
7 TRCN0000075354 CATGCAGTACAACGCCCAGTA pLKO.1 1379 CDS 100% 4.050 2.835 N Nkx2-2 n/a
8 TRCN0000075356 CATCGCTACAAGATGAAACGT pLKO.1 1182 CDS 100% 3.000 2.100 N Nkx2-2 n/a
9 TRCN0000075357 CTTCTCCAAAGCGCAGACCTA pLKO.1 1049 CDS 100% 2.640 1.848 N Nkx2-2 n/a
10 TRCN0000081692 CCAGAACCATCGCTACAAGAT pLKO.1 1175 CDS 100% 4.950 2.475 Y Nkx2-4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.