Transcript: Mouse XM_011240000.2

PREDICTED: Mus musculus butyrylcholinesterase (Bche), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bche (12038)
Length:
6290
CDS:
331..2178

Additional Resources:

NCBI RefSeq record:
XM_011240000.2
NBCI Gene record:
Bche (12038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031832 GCTTTCAAACTGGGACCTCTT pLKO.1 803 CDS 100% 4.050 3.240 N Bche n/a
2 TRCN0000339721 CAGTAGCTCTCTCCATATATA pLKO_005 2236 3UTR 100% 15.000 10.500 N Bche n/a
3 TRCN0000031830 GCTCGTGTTGAAAGAGTTATT pLKO.1 853 CDS 100% 13.200 9.240 N Bche n/a
4 TRCN0000318304 GCTCGTGTTGAAAGAGTTATT pLKO_005 853 CDS 100% 13.200 9.240 N Bche n/a
5 TRCN0000031829 CCTCAGGAAATTCTTCGCAAT pLKO.1 1258 CDS 100% 4.050 2.835 N Bche n/a
6 TRCN0000318229 CCTCAGGAAATTCTTCGCAAT pLKO_005 1258 CDS 100% 4.050 2.835 N Bche n/a
7 TRCN0000031833 GCTCAGATCTTAGTGGGAGTT pLKO.1 1396 CDS 100% 4.050 2.835 N Bche n/a
8 TRCN0000318230 GCTCAGATCTTAGTGGGAGTT pLKO_005 1396 CDS 100% 4.050 2.835 N Bche n/a
9 TRCN0000031831 GCTCCAGGAAACATGGGTTTA pLKO.1 937 CDS 100% 10.800 6.480 N Bche n/a
10 TRCN0000318228 GCTCCAGGAAACATGGGTTTA pLKO_005 937 CDS 100% 10.800 6.480 N Bche n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10695 pDONR223 100% 8.9% 8.2% None (many diffs) n/a
2 ccsbBroad304_10695 pLX_304 0% 8.9% 8.2% V5 (many diffs) n/a
Download CSV